Molecular Identification Protocol for Salvia Species, Including S. miltiorrhiza

A standardized workflow from sample DNA preparation to combined identification, using the ribosomal DNA marker ITS and D-1, a Salvia-specific barcode selected by our team.

Scope

For molecular identification of Salvia species, including S. miltiorrhiza. ITS is a ribosomal DNA marker; D-1 is a Salvia-specific barcode selected by our team.

DNA Extraction and PCR Template Requirements

Extract total genomic DNA from approximately 100 mg of dried leaves using a modified CTAB method. Assess DNA purity and concentration with an ND-2000 spectrophotometer and 0.8% agarose gel electrophoresis.

Dilute DNA to 20–30 ng/μL with TE buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA). Add 20–30 ng of template DNA to each 25 μL PCR reaction; this corresponds to 1 μL at the working concentration above.

ITS and D-1 Primer Information

Target	Primer	Sequence (5′→3′)	Annealing temperature
ITS	ITS 1F	TCCGTAGGTGAACCTGCGG	55°C
ITS	ITS 4R	TCCTCCGCTTATTGATATGC	55°C
D-1	D-F-1	TAATACTACTGCCAGACTTCCTAAT	53°C
D-1	D-R-1	TCAATGTCCGAAGAATATGAGCT	53°C

D-1 candidate region

Approx. 360 bp

40 bp at the 3′ end of ndhI + 320 bp of intergenic region

Reference genome position

116,365–116,724 bp

S. miltiorrhiza chloroplast genome

ITS amplicon

Approx. 470 bp

Ribosomal DNA marker

PCR Reaction Mixture

Set up separate ITS and D-1 reactions for each sample using the corresponding primers. The following is an example 25 μL reaction mixture using AmpliTaq DNA polymerase and a GeneAmp PCR System 9700.

Component	Amount or final concentration per reaction
Template DNA	20–30 ng
AmpliTaq DNA polymerase	0.625 U
PCR buffer	1×
MgCl₂	1.5 mM
dNTP	0.2 mM
Forward primer	0.3 μM
Reverse primer	0.3 μM
ddH₂O	Bring to 25 μL

PCR Cycling Program

Stage	Temperature	Duration	Cycles
Initial denaturation	95°C	4 min	1
Denaturation	94°C	30 s	40 cycles for these three stages
Annealing	ITS 55°C; D-1 53°C	1 min	Same as above
Extension	72°C	1.5 min	Same as above
Final extension	72°C	10 min	1

Product Assessment and Sanger Sequencing

Gel electrophoresis

Check PCR products by electrophoresis on a 1% agarose gel in TAE buffer.

Quality assessment

Proceed to Sanger sequencing if bands are clear, at the expected positions, and free of nonspecific amplification.

Bidirectional sequencing

Use ITS 1F/ITS 4R for ITS and D-F-1/D-R-1 for D-1.

Sequence assembly

Assemble the forward and reverse reads after they are obtained.

Sequence Processing and Combined ITS + D-1 Identification

Generate consensus sequences

Assemble Sanger reads with CodonCode Aligner v.3.7. Generate separate ITS and D-1 consensus sequences, both linked to the same sample ID.

Enter sequences

Enter the ITS and D-1 sequences from the same sample into their respective fields.

Set BLASTn parameters

The default E-value is 1e-5; lower it to filter for higher-confidence results. The default Task is megablast.

Select concatenation mode

direct concatenates the input ITS and D-1 sequences as entered; all also tries combinations using their reverse complements.

Start identification

After setting the parameters, click “Start BLAST Identification” and wait for the results.

Parameter Notes

Task sets the initial word size, scoring matrix, and extension threshold to balance speed against sensitivity to distant homologs. blastn is more sensitive than megablast and detects more distant matches, but can run several times slower.

Reference

[1] Cui, N., Liao, B. S., Liang, C. L., Li, S. F., Zhang, H., Xu, J., Li, X. W., & Chen, S. L. (2020). Complete chloroplast genome of Salvia plebeia: organization, specific barcode and phylogenetic analysis. Chinese Journal of Natural Medicines, 18(8), 563–572.

DOI 10.1016/S1875-5364(20)30068-6

Shandong Academy of Chinese Medicine

Salvia Molecular Identification System · Salvia Molecular Identification Database

GitHub

Blog

Zhihu